Biomedical : Online Tools for Primer Design and Analysis

Online Tool	Description
AutoPrime	Primer design for real-time PCR measurement of eukaryotic gene expression.
CODEHOP	COnsensus-DEgenerate Hybrid Oligonucleotide Primers designed from protein multiple sequence alignments.
ExonPrimer	Design intronic primers for PCR amplification of exons. Input needed: a cDNA and the corresponding genomic sequence.
IDT AntiSense Design	Antisense oligo design and selection tool.
IDT Oligo Analyzer	Online calculation of oligonucleotide parameters such as melting temperature. Shows self-dimers, hairpin, and performs Blast.
IDT PrimerQuest	Primer and probe design and selection.
NetPrimer	Java applet for primer design.
Oligonucleotide Analyzer	Generates Tm, free energy, molecular weight and hairpin and dimer formation structures.
Primer3	Utility for locating oligonucleotide primers for PCR amplification of DNA sequences.
PrimerX	Automated design of mutagenic primers for site-directed mutagenesis.
Primo Pro	PCR Primer Design.
QuantPrime	Automatic high-throughput primer pair design and specificity testing for realtime qPCR on any organism.
RNAi Design	Design duplexed RNA oligos for RNA interference.
SiteFind	Design of oligonucleotide primers for site-directed-mutageneis that include a novel restriction for use as a marker of successful mutation.
UCSC In-Silico PCR	In-Silico PCR searches a genome sequence database with a given pair of PCR primers.
Web Primer	Primer design and sets for amplifying yeast ORFs.

Primer Design Considerations

Desired characteristics of automated DNA sequencing primer design.

• Based on accurate sequence
• Melting temperature (Tm): 52°C to 65°C
• Absence of self-hybridization
• Absence of significant hairpin formation (>3 bp)
• Lack of secondary priming sites
• Low specific binding at the 3' end (ie. lower GC content to avoid mispriming)

• PCR Application Manual
• PrimerBank: PCR primers for gene expression detection or quantification
• How Real-Time PCR Works
• Notes on Primer Design in PCR
• Primers for Automated Sequencing

Primer Design

What is a primer?

A primer is a short synthetic oligonucleotide which is used in many molecular techniques from PCR to DNA sequencing. These primers are designed to have a sequence which is the reverse complement of a region of template or target DNA to which we wish the primer to anneal.

Analysis of primer sequences

When designing primers for PCR, sequencing or mutagenesis it is often necessary to make predictions about these primers, for example melting temperature (Tm) and propensity to form dimers with itself or other primers in the reaction. The following program will perform these calculations on any primer sequence or pair.

IDT DNA (Select Oligo Analyzer)

The programs will calculate both the Tm of the primers, as well as any undesireable pairings of primers. When primers form hairpin loops or dimers less primer is available for the desired reaction. For example...

Some thoughts on designing primers.

1. primers should be 17-28 bases in length;
2. base composition should be 50-60% (G+C);
3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming;
4. Tms between 55-80^oC are preferred;
5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product;
6. primer self-complementarity (ability to form 2^o structures such as hairpins) should be avoided;
7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.

(adapted from Innis and Gelfand,1991)

Also keep in mind that most oligonucleotide synthesis reactions are only 98% efficient. This means that each time a base is added, only 98% of the oligos will receive the base. This is not often critical with shorter oligos, but as length increases, so does the probability that a primer will be missing a base. This is very important in mutagenesis or cloning reactions. Purification by HPLC or PAGE is recommended in some cases.

Oligonucleotide length	Percent with correct sequence
10 bases	(0.98)10 = 81.7%
20 bases	(0.98)20 = 66.7%
30 bases	(0.98)30 = 54.6%
40 bases	(0.98)40 = 44.6%

Designing Degenerate Oligonucleotides.

A group of degenerate oligonucleotides contain related sequences with differences at specific locations. These are used simultaneously in the hope that one of the sequences of the oligonucleotides will be perfectly complementary to a target DNA sequence.

One common use of degenerate oligonucleotides is when the amino acid sequence of a protein is known. One can reverse translate this sequence to determine all of the possible nucleotide sequences that could encode that amino acid sequence. A set of degenerate oligonucleotides would then be produced matching those DNA sequences. The following link will take you to a program that will perform a reverse translation. http://arbl.cvmbs.colostate.edu/molkit/rtranslate/

For example, the amino acid sequence shown in purple below could be encoded by the following codons.

AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C G C CT CAGC C C T C C C G
A A A A A
G G G G G

One could then select the 14 base sequence (in blue) to generate a smaller set of degenerate oligonucleotides. Each oligonucleotide in the set would have one base changed at a time (shown in purple below). A total of 32 unique oligonucleotides would be generated.

TATTGTTGGCTTCC

TACTGTTGGCTTCC

TATTGCTGGCTTCC

TACTGCTGGCTTCC

etc.

When ordering degenerate oligonucleotides, you just let the company know that you want a mixture of nucleotides added at a specific position using the code below. By adding the mixture, oligos will incorporate one of the bases, leading to a mixture of oligonucleotides.

Standard MixBase Definitions
	A, G
	C, T
	A, C
	G, T
	C, G
	A, T
	A, C, T
	C, G, T
	A, C, G
	A, G, T
	A, C, G, T

Design primers 15-25 bp long that will amplify both of the sequences below. You may wish to use an Alignment program to identify conserved regions in both sequences. These sites would be good targets for PCR primers to bind to both sequences. Recall that the two primers need to bind to the target DNA such that the free 3´ ends of each primer point towards each other. You may wish to review the rules used design primers. After you have identified the sequence of your primers, check the primers with the programs used to calculate melting temperature (Tm) and the formation of primer dimers. If the Tm is less than 55oC or bad hairpins or dimers form, try another region of sequence. A link to one possible answer is given at the bottom of the page. >Paddlefish CCTTGGCCTCTGCCTAATCACACAGATTCTAACAGGATTATTTCTCGCAATACACTACACAGCTGACA TCTCAACAGCCTTCTCCTCCGTCGCCCACATCTGTCGAGATGTTAACTACGGATGACTAATTCGAAAC ATTCATGCAAACGGAGCCTCCTTTTTCTTCATCTGCCTCTACCTTCACGTAGCCCGAGGCATATACTA TGGCTCATACCTCTACAAAGAAACCTGAAACATCGGAGTAGTTCTCCTACTCCTAACTATAATAACCG CCTTCGTAGGATATGTGCTCCCATGAGGACAGATATCCTTCTGAGGAGCCACCGTAATTACCAACCTT CTTTCCGCCTTCCCCTACATCGGGGACACCCTAGTACAATGAATCTGAGGTGGTTTCTCAGTAGACAA CGCCACCCTAACC >Shovenose Sturgeon CCTAGGCCTCTGCCTTATTACACAAATCTTAACAGGACTATTTCTTGCAATACACTACACAGCTGACA TTTCAACAGCCTTCTCCTCCGTCGCCCACATCTGCCGAGACGTAAACTACGGGTGACTAATCCGAAAC GTCCACGCAAATGGCGCCTCCTTCTTCTTTATCTGCTTGTACCTTCACGTCGCACGAGGTATATACTA CGGCTCCTACCTCCAAAAAGAAACCTGAAACATCGGAGTAGTCCTCTTACTCCTCACCATAATAACCG CCTTCGTAGGCTATGTACTGCCCTGAGGACAAATATCATTTTGAGGGGCAACCGTAATCACTAACCTC CTTTCCGCCTTCCCGTACATCGGCGACACATTAGTGCAATGAATCTGAGGCGGCTTTTCAGTC

	Upon aligning the two sequences you would get the results below. A vertical line indicates that the base is conserved in the two sequences, the absence of a line indicates a change. This makes it easy to identify conserved regions which would be good sites for a primer to bind to both sequences. There are many possible answers to this problem. The two below are not necessarily the best, try several primer sequences to see which work best. The sequence ccttggcctctgcct would make a good first primer. There is only one mis-match. However, it only has a Tm of 54oC and forms a hairpin and dimers. Instead, the sequence gccttctcctccgtcgccc is 74% GC with a Tm of 63oC and doesn´t form hairpins or dimers. This would be a better primer, but the PCR product would be about 100 bp shorter. This would make a decent Primer 1. Similarly the sequence cgatgtaggggaaggcggaaag is 59% GC with a Tm of 61oC and doesn´t form hairpins or dimers. This would make a good Primer 2.

Query: 1 ccttggcctctgcctaatcacacagattctaacaggattatttctcgcaatacactacac 60 ||| ||||||||||| || ||||| || |||||||| ||||||| |||||||||||||| Sbjct: 1 cctaggcctctgccttattacacaaatcttaacaggactatttcttgcaatacactacac 60 Primer 1 5´gccttctcctccgtcgccc 3´ Query: 61 agctgacatctcaacagccttctcctccgtcgcccacatctgtcgagatgttaactacgg 120 ||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||| Sbjct: 61 agctgacatttcaacagccttctcctccgtcgcccacatctgccgagacgtaaactacgg 120 Query: 121 atgactaattcgaaacattcatgcaaacggagcctcctttttcttcatctgcctctacct 180 |||||||| |||||| | || ||||| || |||||||| ||||| |||||| | ||||| Sbjct: 121 gtgactaatccgaaacgtccacgcaaatggcgcctccttcttctttatctgcttgtacct 180 Query: 181 tcacgtagcccgaggcatatactatggctcatacctctacaaagaaacctgaaacatcgg 240 |||||| || ||||| |||||||| ||||| |||||| | |||||||||||||||||||| Sbjct: 181 tcacgtcgcacgaggtatatactacggctcctacctccaaaaagaaacctgaaacatcgg 240 Query: 241 agtagttctcctactcctaactataataaccgccttcgtaggatatgtgctcccatgagg 300 |||||| ||| ||||||| || |||||||||||||||||||| ||||| || || ||||| Sbjct: 241 agtagtcctcttactcctcaccataataaccgccttcgtaggctatgtactgccctgagg 300 Primer 2 3´gaaaggcggaaggggatgta Query: 301 acagatatccttctgaggagccaccgtaattaccaaccttctttccgccttcccctacat 360 ||| ||||| || ||||| || |||||||| || ||||| |||||||||||||| ||||| Sbjct: 301 acaaatatcattttgaggggcaaccgtaatcactaacctcctttccgccttcccgtacat 360 gc 5´ Query: 361 cggggacaccctagtacaatgaatctgaggtggtttctcagt 402 ||| ||||| |||| |||||||||||||| || || ||||| Sbjct: 361 cggcgacacattagtgcaatgaatctgaggcggcttttcagt 402

Purpose: to use a database to design specific PCR primers to amplify a region of DNA. Go to Biology Workbench and log in. Select Session Tools and then New Session. Name the New Session Deer Bone Next select Nucleic Tools and then Ndjinn (this is a search engine for DNA and protein sequences) In the search window enter the following three ascession numbers separated by "or" AF016978 OVU12869 BBU12864 Next scroll down and click the box next to the term GBMAM (GenBank Mammal) When the three sequences appear, select Import Sequences These three sequences will now be imported into your Deer Bone folder. What region of DNA do these sequences correspond to? From which species? Click on the boxes next to each sequence file and then select CLUSTALW This program will align the three sequences. Your assignment is to use this aligned sequence to design PCR primers which will amplify all three DNAs. The Tm of the primers should be >50C. Also design the primers such that the PCR products from the two different species will be different sizes. This will allow for rapid identification of the species. To check the Tm of primers use the program on the page PRIMER DESIGN in BioWeb. To be turned in for credit: qPrint out the report for the two primers you end up choosing, showing the Tm, length, etc. qTurn in a printout of the aligned sequences with the location of the two primers indicated. qWhat sized PCR product will you generate in each species?

pSET151

PDF Files Related to pSET151

http://jb.asm.org/cgi/reprint/184/20/5746.pdf

www.jbc.org/content/suppl/.../SD_for_M8-04971_(revised-080908).pdf

Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST).

Free Software Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST).



http://www.ncbi.nlm.nih.gov/tools/primer-blast/

Design of Primers for Automated Sequencing

One of the most important factors in successful automated DNA sequencing is proper primer design. This document describes the steps involved in this process and the major pitfalls to avoid.

---

**** Use a Computer to Design Primers ****

We highly recommend that a computer be used during primer design in order to check for certain fatal design flaws. Numerous programs are capable of performing this analysis. We generally use 'Oligo' (National Biosciences, Inc, Plymouth MN), a program for the Macintosh that has produced excellent results in our hands. Two other programs you might consider are MacVector (Kodak/IBI) and the GCG suite of sequence analysis programs, but many others are available as well.

---

Some Basic Concepts: If you are confused by the strands and primer orientation, read this.

Sequencing primers must be able to anneal to the target DNA in a predictable location and on a predictable strand. They furthermore must be capable of extension by Taq DNA Polymerase.

Some people are confused about how to examine a DNA sequence to choose an appropriate primer sequence. Here are a few things for novices to remember:

• Sequences are always written from 5' to 3'. This includes the sequence of your template DNA (if known), the sequence of the vector DNA into which it is inserted, and the sequence of proposed primers. Don't ever write a primer sequence reversed or you will only confuse yourself and others.
• Polymerase always extends the 3' end of the primer, and the sequence you will read will be the same strand (sense or anti-sense) as the primer itself.
• Thus, if you choose a primer sequence that you can read in your source sequence (for example, in the vector), the sequence you will obtain will extend from the primer's right (3') end.
• Conversely, if you choose a primer from the strand opposite to what your 'source' sequence reads, the resulting sequence will read towards the left.

Here are a couple of examples: Suppose you have a vector with the following sequence around the Multiple Cloning Site (the 'MCS'): TTAGCTACTGCTTGATGCTAGTACTACATCTAGTGCTAGATGGATCCGAATTCGCTGATGCTCATATGTTAATAAAGAC ^ ^ | | BamHI EcoRI If you cloned your DNA of interest between the BamHI and EcoRI sites, you could sequence using the primer 'CTTGATGCTAGTACTACATC' (remember - that's written 5' to 3') and you'll obtain the following sequence from the Core: TAGTGCTAGATG[your-insert-'top'-strand-Bam-to-Eco]AATTCGCTGATGC...(etc.) What if you wanted sequence from the other strand - Eco to Bam - instead? In that case, you need to select some sequence on the right and then reverse-complement it before requesting the oligo. Picking out some sequence from the figure above: CTGATGCTCATATGTTAATA This is NOT the primer sequence - it is copied verbatim from the above sequence. In fact, if you used this sequence for a primer, sequencing would proceed towards the right, away from your insert. Instead, reverse-complement that sequence: TATTAACATATGAGCATCAG NOW this should produce sequence of the opposite strand: CGAATT[your-insert-'bottom'-strand-Eco-to-Bam]CATCTAGCACTA...(etc.) Some fine print: Only rarely does sequencing actually show the nucleotides immediately downstream from the primer. I've taken some didactic license in the examples above.

---

More Advanced Concepts: How to Design a Primer that Works.

Generally you are starting with some small amount of known sequence that you wish to extend. Here's how to proceed:

I. Design primers only from accurate sequence data.

Automated sequencing (and in fact any sequencing) has a finite probablility of producing errors. Sequence obtained too far away from the primer must be considered questionable. To determine what is 'too far', we strongly suggest that our clients read the memo Interpretation of Sequencing Chromatograms, which describes how to assess the validity of data obtained from the ABI sequencers. Select a region for primer placement where the possibility of sequence error is low.

II. Restrict your search to regions that best reflect your goals.

You may be interested in maximizing the sequence data obtained, or you may only need to examine the sequence at a very specific location in the template. Such needs dictate very different primer placements.

1. Maximize sequence obtained while minimizing the potential for errors:

   Generally, you should design the primer as far to the 3' as you can manage so long as you have confidence in the accuracy of the sequence from which the primer is drawn. Primers on opposite strands should be placed in staggered fashion as much as possible.

2. Targetted sequencing of a specific region:

   Position the primer so the desired sequence falls in the most accurate region of the chromatogram. Sequence data is often most accurate about 80-150 nucleotides away from the primer. Do not count on seeing good sequence less than 50 nucleotides away from the primer or more than 300 nt away (although we often get sequence starting immediately after the primer, and we often return 700 nt of accurate sequence).

III. Locate candidate primers:

Identify potential sequencing primers that produce stable base pairing with the template DNA under conditions appropriate for cycle sequencing. It is strongly suggested that you use a computer at this step.
Suggested primer characteristics:

1. Length should be between 18 and 30 nt, with optimal being 20-25 nt. (Although we have had some successes with primers longer than 30 and shorter than 18).
2. G-C content of 40-60% is desirable.
3. The Tm should be between 55 C and 75 C. Warning: the old "4 degrees for each G-C, 2 degrees for each A-T" rule works poorly, especially for oligos shorter that 20 or longer than 25 nt. Instead, try:

   Tm = 81.5 + 16.6* log[Na] + 0.41*(%GC) - 675/length - 0.65*(%formamide) - (%mismatch)                    

   There's a web-based Tm calculator you might try at http://www.rnature.com/oligonucleotide.html.
   

IV. Discard candidate primers that show undesirable self-hybridization.

Primers that can self-hybridize will be unavailable for hybridization to the template. Generally avoid primers that can form 4 or more consecutive bonds with itself, or 8 or more bonds total. Example of a marginally problematic primer:

                   5'-ACGATTCATCGGACAAAGC-3'
                      ||||  ||||
           3'-CGAAACAGGCTACTTAGCA-5'
    

This oligo forms a substantially stable dimer with itself, with four consecutive bonds at two places and a total of eight inter-strand bonds.

Primers with 3' ends hybridizing even transiently will become extended due to polymerase action, thus ruining the primer and generating false bands. Be somewhat more stringent in avoiding 3' dimers. For example, the following primer self-dimerizes with a perfect 3' hybridization on itself:

                 5'-CGATAGTGGGATCTAGATCCC-3'
                          ||||||||||||||
                       3'-CCCTAGATCTAGGGTGATACG-5'
    

The above oligo is pretty bad, and almost guaranteed to cause problems. Note that the polymersase will extend the 3' end during the sequencing reaction, giving very strong sequence ACTATGC. These bands will appear at the start of your 'real' data as immense peaks, occluding the correct sequence. Most primer design programs will correctly spot such self-dimerizing primers, and will warn you to avoid them.

Note however that no computer program or rule-of-thumb assessment can accurately predict either success or failure of a primer. A primer that seems marginal may perform well, while another that appears to be flawless may not work at all. Avoid obvious problems, design the best primers you can, but in a pinch if you have few options, just try a few candidate primers, regardless of potential flaws.

V. Verify the site-specificity of the primer.

Perform a sequence homology search (e.g. dot-plot homology comparison) through all known template sequence to check for alternative priming sites. Discard any primers that display 'significant' tendancy to bind to such sites. We can provide only rough guidelines as to what is 'significant'. Avoid primers where alternative sites are present with (1) more than 90% homology to the primary site or (2) more than 7 consecutive homologous nucleotides at the 3' end or (3) abundance greater than 5-fold higher than the intended priming site.

VI. Choosing among candidate primers.

If at this point you have several candidate primers, you might select one or a few that are more A-T rich at the 3' end. These tend to be slightly more specific in action, according to some investigators. You may want to use more than one primer, maximizing the likelihood of success.

If you have no candidates that survived the criteria above, then you may be forced to relax the stringency of the selection requirements. Ultimately, the test of a good primer is only in its use, and cannot be accurately predicted by these simplistic rules-of-thumb.

---

Go to the University of Michigan DNA Sequencing Core's Home Page

PCR and Primer Design Bioinformatic Tools

GeneFisher Interactive Primer Design GeneFisher Interactive Primer Design Tool.

MethPrimer MethPrimer is a program for designing...

OligoAnalyzer OligoAnalyzer tool for oligonucleotide analysis. Includes...

OligoCalc Calculate your primer parameters Melting temperature Tm,...

PCR Mastermix Box Titration Calculator This Bioinformatic Tool determines the amount of various...

PCR Optimization Program Helper PCR Optimization Program Helper. The program helps to...

Primer3 Primer3: pick primers from a DNA sequence. Great program.

The PCR Suite The PCR Suite. A collection of bioinformatic tools that...

WebPrimer WebPrimer. The easiest and best PCR tool we have used.

Designing Primers for PCR

The Primer Designer features a powerful, yet extremely simple, real-time interface to allow the rapid identification of theoretical ideal primers for your PCR reactions. Primer pairs are computed from the set target regions, then screened against a series of parameters to maximise priming efficiency for trouble-free PCR.

The Display

The main Primer Designer form essentially consists of two grids and some parameter controls. The grids show all the possible forward (left side) and reverse (right side) primers that conform to the set parameters, and fall within the specified target regions for each primer. You will immediately notice, that by making the selection conditions for the primers more stringent, the list of possible primers will diminish. This real-time screening process makes it possible to very quickly narrow down the list of potential primers, and select the one(s) that best suit the needs for your experiment.

The regions from which the primers are chosen can be visualised and adjusted on the Interactive Sequence Map. The regions are represented by outlined boxes, colored green for the forward primers and purple for the reverse primers. The regions can be shifted by dragging them with the mouse, and their size adjusted by clicking on their edges and stretching them to the desired size. For fine adjustment of the region's position or size, simply select the whole box or the appropriate edge, then use the left and right arrows to shift your selection to the exact desired position. The primer selection regions are also shown in the Sequence Editor as light green and purple shaded regions.

The positions of the currently selected forward and reverse primers in the tables on the Primer Designer form, are shown on the Interactive Sequence Map as solid green and purple bars, and on the Sequence Editor as darkly shaded green and purple regions.

Adjusting the Primer Selection Parameters

Various parameters can be adjusted on the Primer Designer form, allowing you to specify how the primers will be screened. Although the default settings of the parameters are adequate for a typical PCR reaction, you will probably need to adjust them to some extent depending on the nature of your experiment. The parameters and their functions are outlined in the table below:

Parameter	Function
Length Range	Specifies the minimum and maximum lengths of the primers.
%GC Range	Specifies the minimum and maximum percentage of GC content in the primer. Efficient primers generally have %GCs of around 50.
Tm Range	Specifies the minimum and maximum melting temperature (in degrees Celcius) of the primer, as calculated by the Nearest Neighbor method (see below).
3' End Stability	Determines the DG of the last 5 bases at 3' end. An unstable 3' end (less negative DG) will result in less false priming.
5' End Stability (GC Clamp)	Determines the DG of the last 5 bases at 5' end. A stable 5' end (more negative DG) will result in more efficient and specific bonding to the template.
DG Dimer	Specifies the minimum tolerable DG for primer dimer formation.
DG Hairpin	Specifies the minimum tolerable DG for primer hairpin formation.

In the functions above, all the DG values are calculated according to nearest-neighbor method (Breslaur et al., 1986).

There are three commonly used methods for calculating the Tm. Expression uses the most accurate method, nearest-neighbor. The formulas and references for the different methods are summarised in the table below:

Method	Formula	Reference
Arbitrary	2(A + G) + 4(G + C)	Wallace et al. (1979)
Nearest Neighbor	(-1000 x deltaH) / (-10.8 - deltaS + R x ln(2.5^c/4)) - 273.15 - 16.6(log10 M) where c is the molar concentration of primer (set at 250 pM), M is the molar concentration of Na+ (set at 50 mM), and R is the gas constant (1.987)	Breslaur et al. (1986); Rychlik et al. (1990)
Long probe	81.5 + 16.6(log10 M) + 0.41(% GC) - 0.61(% form) - 500 / Length in bp where M is the molarity of Na+ (set at 0.75 M) and % form is the percentage of formamide (set to 50%)	Meinkoth and Wahl (1984)

Annotating your Primers

Once you have finished refining the stringency of your primer screening, and spotted the primers you would like to use, you can annotate their positions, and that of the PCR product, into your sequence for future reference. To do this, simply highlight the forward and reverse primers of choice by clicking on them on the tables on the Primer Designer form, and push the Annotate button. It really is that easy.

References

Breslaur KJ, Frank R, Blocker H, and Marky LA (1986). Predicting DNA duplex stability from the base sequence. Proc Natl Acad Sci, 83:3746-3750.

Meinkoth J, and Wahl G (1984). Hybridization of nucleic acids immobilized on solid supports. Anal Biochem, 138(2):267-284

Rychlik W, Spencer WJ, and Rhoads RE (1990). Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res, 18(21):6409-6412.

Wallace RB, Shaffer J, Murphy RF, Bonner J, Hirose T, and Itakura K (1979). Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch. Nucleic Acids Res, 6(11):6353-6357.

Related Articles

Using the Sequence Map

Annotating Your Sequences

Return to Expression Overview